Random Transcendentalism

Cell Division
Magnetism

The religion that is afraid of science dishonors God and commits suicide . . .

Standing on the bare ground, my head bathed by the blithe air, and uplifted into infinite space, all mean egotism vanishes. I become a transparent eyeball. I am nothing; I see all; the currents of the Universal Being circulate through me. I am part or particle of God . . .

There is no screen or ceiling between our heads and the infinite heavens . . . no bar or wall in the soul where we, the effect, cease, and God, the cause, begins.

Ralph Waldo Emerson, various essays

I believe in the flesh and the appetites; Seeing, hearing, feeling, are miracles, and each part and tag of me is a miracle.
Divine am I inside and out, and I make holy whatever I touch and am touch’d from;

Walt Whitman, "Leaves of Grass"

Circular Crops

I'm Ready

(this picture doesn't have anything to do with anything; I just wanted to put a picture in this post)


Take me to the Stepfordizer. I've decided that I just really don't like being human. There are just too many discomforts and other hassles. Come to think about it, I've never really liked being human. I must have done something terrible in my past lives. ;-) Can I be a robot instead of a human now?

Fortune Cookie

make your own fortune cookie

DNA Message

AGAATGTAGGGCTAAGCGCTGATGGTACTTCGTGCGGCGT
CAATGGCGGATGCCCTTATGGTTGGCATGGTCCGTTCAATGGTCG
GCGCTCTTGTTGAGGATGGAGACATGTACCTTGTATCAATGCTG
GATGTAGTTTCAATGCTATAAGTTATGAGAGCGGCGATGCT
TTATCTTGTACTCGATGTCCTTATGGTCGGCGCTCTTATGGTCCTTG
CGGAAATGCTCGGCGGAGTTGTAGGCGCGATGGTTGAG
GATGTCATGGTTGATGCTCTTGTG

(I had to break it up into several lines so it would fit on the page. To decode it you'll have to return it to a whole, long string.)


Create and decode a message in DNA.

What People Are Looking For

It's interesting to note the search terms that bring people here. Currently, the most popular searches are for "birthday verses" which lands people here.

TMI Tuesday

Because I'm lacking the time and imagination to come up with my own ideas this week, I'm borrowing an idea from here, a blog devoted to TMI Tuesday memes.


1. My biggest sexual turn on is __________?

kissing

2. On a scale of 1-10, how jealous do you get (have you gotten)?

been to 10 a few times

3. Have you ever had sex with someone you work(ed) with? Any negative consequences?

yes, no

4. Wash up, cuddle or fall asleep?

depends on many factors

5. Which is more important of the two in "chemistry," physical attractiveness or sexual performance?

performance

6. Do you regret any past sexual partner, sexual liaison, or missed opportunity for one?

yes, yes, and yes

7. Have you had sex with a virgin after you lost your virginity?

yes, but he was older than me (at least he told me he was a virgin)

8. What is your favorite sexual position? If different, which one do you enjoy the most?

well, that is definitely too much information

Bonus (as in optional): What kind of birth control do you use?

sterilization, 100% effective

Close Enough for Rock 'n' Roll

Jesus quote generator

Please don't crucify me!